Calculation Type


Sequence Information

Length: 25 bp | 48% GC

Parameters







Tm(°C):

X

Degredation

If the polymerase is 5'-exonuclease positive (hydrolysis probe, TaqMan, etc.) then some probe degredation (about 10%) will occur.

If the polymerase is 5'-exonuclease negative (hybridization probe, Klentaq, etc.), no degredation will occur.

X

Conversion

The percentage of the primers that are converted to product.

When the primer concentrations are not equal, this is the percentage of the primers remaining after the exponential phase that are converted to product.

X

Available

Only a percentage of the primer that is converted to product will be available to hybridize to the probe (some forms double stranded product).

X

About Tm Tool v1.0b

This tool was created to aid in the prediction of melting temperatures for primers, probes, and small oligos.

As a beta version, feedback is always welcome and users can contact us zach.dwight [at] path.utah.edu.

Disclaimer: Access to software and related materials are provided as a courtesy, free of charge, and are intended for informational and educational purposes only. Any use of this software and such related materials shall be at the sole and exclusive risk of the user(s). Full disclaimer can be found on dna.utah.edu.

X

Parameter Definitions

[Mono+]: Concentration of monovalent cations.

[Mg++] : Concentration of magnesium.

[Total dNTPs]: Concetration of dNTPs in solution.

Free [Mg++]: Final concentration after dNTPs are subtracted from [Mg++]

Thermodynamic Library: Published nearest neighbor parameters to use in calculation.

Salt Correction: Algorithm for [Mono+] and [Mg++] corrections to use in calculation.

X

Additional Sequence Information

Reverse:

GCTACGATGCATCGATTCACGTGAA


Complement:
TTCACGTGAATCGATGCATCGTAGC


Reverse Complement:
CGATGCTACGTAGCTAAGTGCACTT